Product Details

SNP ID: rs3177008
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:11276219 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAGCAGTGTCTGCGCCTATAGTGA[A/G]ACTGGCCATGGGTCCTCTCGTAGAC
Phenotype: MIM: 182880 MIM: 182890 MIM: 190232
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PRM1 PubMed Links

Gene Details

Gene: PRM1
Gene Name: protamine 1

There are no transcripts associated with this gene.

Gene: PRM2
Gene Name: protamine 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286356.1	262	Missense Mutation	TCT,TTT	S51F	NP_001273285.1
NM_001286357.1	262	Missense Mutation	TCT,TTT	S51F	NP_001273286.1
NM_001286358.1	262	Missense Mutation	TCT,TTT	S51F	NP_001273287.1
NM_001286359.1	262	Missense Mutation	TCT,TTT	S51F	NP_001273288.1
NM_002762.3	262	Missense Mutation	TCT,TTT	S51F	NP_002753.2

Gene: PRM3
Gene Name: protamine 3

There are no transcripts associated with this gene.

Gene: TNP2
Gene Name: transition protein 2 (during histone to protamine replacement)

There are no transcripts associated with this gene.

View Full Product Details