Product Details

SNP ID
rs3172033
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.2:179442154 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TTCCAGTCTTGTTGATATCGGCTTA[A/G]AAAGGGGGGCATGGGAGCATGACCT
Phenotype
MIM: 612344
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
ZNF385B PubMed Links
Additional Information
For this assay, SNP(s) [rs111664903] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ZNF385B
Gene Name
zinc finger protein 385B
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001113397.1 2432 UTR 3 NP_001106868.1
NM_001113398.1 2432 UTR 3 NP_001106869.1
NM_001282725.1 2432 UTR 3 NP_001269654.1
NM_152520.4 2432 UTR 3 NP_689733.3
XM_011510713.2 2432 UTR 3 XP_011509015.1
XM_011510714.2 2432 UTR 3 XP_011509016.1
XM_011510715.2 2432 UTR 3 XP_011509017.1
XM_011510716.2 2432 UTR 3 XP_011509018.1
XM_011510717.2 2432 UTR 3 XP_011509019.1
XM_011510719.2 2432 UTR 3 XP_011509021.1
XM_011510720.2 2432 UTR 3 XP_011509022.1
XM_011510721.2 2432 UTR 3 XP_011509023.1
XM_011510723.2 2432 Intron XP_011509025.1
XM_017003435.1 2432 UTR 3 XP_016858924.1
XM_017003436.1 2432 UTR 3 XP_016858925.1
XM_017003437.1 2432 UTR 3 XP_016858926.1
XM_017003438.1 2432 UTR 3 XP_016858927.1
XM_017003439.1 2432 UTR 3 XP_016858928.1
XM_017003440.1 2432 UTR 3 XP_016858929.1
XM_017003441.1 2432 Intron XP_016858930.1

View Full Product Details