Product Details

SNP ID: rs3177436
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1984945 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGTGCTGAAGACCTAAGAAAAAGG[C/T]AAGATGTGTTTGCACGCAGCAGAGC
Phenotype: MIM: 600924 MIM: 611256 MIM: 603927 MIM: 605915
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GFER PubMed Links

Gene Details

Gene: GFER
Gene Name: growth factor, augmenter of liver regeneration

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005262.2		Intron			NP_005253.3

Gene: NOXO1
Gene Name: NADPH oxidase organizer 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267721.1		Intron			NP_001254650.1
NM_144603.3		Intron			NP_653204.1
NM_172167.2		Intron			NP_751907.1
NM_172168.2		Intron			NP_751908.1

Gene: SYNGR3
Gene Name: synaptogyrin 3

There are no transcripts associated with this gene.

Gene: TBL3
Gene Name: transducin beta like 3

There are no transcripts associated with this gene.

View Full Product Details