Product Details

SNP ID: rs3183512
Assay Type: Functionally tested
NCBI dbSNP Submissions: 1
Location: Chr.1:153960338 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCCTAGAGGTGTCATGCATGAGAA[C/G]AGGATCCCACAGCCAGCCACCACCT
Phenotype: MIM: 607138 MIM: 608972 MIM: 604740
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CREB3L4 PubMed Links

Gene Details

Gene: CREB3L4
Gene Name: cAMP responsive element binding protein 3 like 4

There are no transcripts associated with this gene.

Gene: CRTC2
Gene Name: CREB regulated transcription coactivator 2

There are no transcripts associated with this gene.

Gene: MIR6737
Gene Name: microRNA 6737

There are no transcripts associated with this gene.

Gene: SLC39A1
Gene Name: solute carrier family 39 member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271957.1	1083	Silent Mutation	CTC,CTG	L245L	NP_001258886.1
NM_001271958.1	1083	Silent Mutation	CTC,CTG	L245L	NP_001258887.1
NM_001271959.1	1083	Silent Mutation	CTC,CTG	L245L	NP_001258888.1
NM_001271960.1	1083	Silent Mutation	CTC,CTG	L245L	NP_001258889.1
NM_001271961.1	1083	UTR 3			NP_001258890.1
NM_014437.4	1083	Silent Mutation	CTC,CTG	L245L	NP_055252.2

View Full Product Details