Product Details

SNP ID: rs3749036
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:170716430 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCAGGCTCTTCCACCCGTGGACC[A/G]CCGACATGCCGGCGCACTCGCCAGG
Phenotype: MIM: 609391
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LINC01124 PubMed Links

Gene Details

Gene: LINC01124
Gene Name: long intergenic non-protein coding RNA 1124

There are no transcripts associated with this gene.

Gene: LOC101926913
Gene Name: uncharacterized LOC101926913

There are no transcripts associated with this gene.

Gene: SP5
Gene Name: Sp5 transcription factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001003845.2	389	Missense Mutation	ACC,GCC	T75A	NP_001003845.1
XM_005246542.4	389	Missense Mutation	ACC,GCC	T119A	XP_005246599.1
XM_011511159.2	389	Missense Mutation	ACC,GCC	T131A	XP_011509461.1

View Full Product Details