Product Details

SNP ID: rs3743034
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:40808947 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTGGCTTGAATAAGGTACTGGAAAC[C/T]GAGGAATTGCTTTACTCACCATCCC
Phenotype: MIM: 616844 MIM: 613256
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DNAJC17 PubMed Links

Gene Details

Gene: DNAJC17
Gene Name: DnaJ heat shock protein family (Hsp40) member C17

There are no transcripts associated with this gene.

Gene: PPP1R14D
Gene Name: protein phosphatase 1 regulatory inhibitor subunit 14D

There are no transcripts associated with this gene.

Gene: ZFYVE19
Gene Name: zinc finger FYVE-type containing 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077268.1	1267	Intron			NP_001070736.1
NM_001258420.1	1267	Intron			NP_001245349.1
NM_001258421.1	1267	Intron			NP_001245350.1
NM_032850.4	1267	Intron			NP_116239.3
XM_017022683.1	1267	UTR 5			XP_016878172.1
XM_017022684.1	1267	Intron			XP_016878173.1

View Full Product Details