Product Details

SNP ID: rs3759825
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:69417347 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAAGTGAAAAATCAGGCAAAAGGTC[A/G]AACTTTCTTCTTAAAGCACCTTCCT
Phenotype: MIM: 605064 MIM: 607781
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KIF23 PubMed Links

Gene Details

Gene: KIF23
Gene Name: kinesin family member 23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001281301.1		Intron			NP_001268230.1
NM_004856.6		Intron			NP_004847.2
NM_138555.3		Intron			NP_612565.1
XM_005254796.2		Intron			XP_005254853.1
XM_005254797.2		Intron			XP_005254854.1
XM_005254798.2		Intron			XP_005254855.1
XM_005254799.2		Intron			XP_005254856.1
XM_011522238.1		Intron			XP_011520540.1
XM_011522239.2		Intron			XP_011520541.1
XM_011522240.1		Intron			XP_011520542.1
XM_017022733.1		Intron			XP_016878222.1

Gene: LOC145694
Gene Name: uncharacterized LOC145694

There are no transcripts associated with this gene.

Gene: PAQR5
Gene Name: progestin and adipoQ receptor family member 5

There are no transcripts associated with this gene.

View Full Product Details