Product Details

SNP ID

rs3811563

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.2:239052272 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GACGGCTGGTGCCCGTGCTTGAGGC[A/G]TCAGGCCAGCTCGCGGTGCCAGCAC

Phenotype

MIM: 605314

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

HDAC4 PubMed Links

Additional Information

For this assay, SNP(s) [rs144468158] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

HDAC4

Gene Name

histone deacetylase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006037.3	4320	UTR 3			NP_006028.2
XM_006712877.3	4320	UTR 3			XP_006712940.1
XM_006712878.3	4320	UTR 3			XP_006712941.1
XM_006712879.3	4320	UTR 3			XP_006712942.1
XM_006712880.3	4320	UTR 3			XP_006712943.1
XM_011512217.2	4320	UTR 3			XP_011510519.1
XM_011512218.2	4320	UTR 3			XP_011510520.1
XM_011512219.2	4320	UTR 3			XP_011510521.1
XM_011512220.2	4320	UTR 3			XP_011510522.1
XM_011512221.1	4320	UTR 3			XP_011510523.1
XM_011512222.2	4320	UTR 3			XP_011510524.1
XM_011512223.2	4320	UTR 3			XP_011510525.1
XM_011512224.2	4320	UTR 3			XP_011510526.1
XM_011512225.2	4320	UTR 3			XP_011510527.1
XM_011512226.2	4320	UTR 3			XP_011510528.1
XM_011512227.2	4320	UTR 3			XP_011510529.1
XM_011512230.1	4320	UTR 3			XP_011510532.1
XM_017005394.1	4320	UTR 3			XP_016860883.1
XM_017005395.1	4320	UTR 3			XP_016860884.1

View Full Product Details