Product Details

SNP ID: rs3759096
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:56153026 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTGAATACTCATGGAGCCATAGGAG[C/G]GCCCACATCCTCTTGGATTAGGGAA
Phenotype: MIM: 616670 MIM: 609931 MIM: 609930 MIM: 601734
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ESYT1 PubMed Links

Gene Details

Gene: ESYT1
Gene Name: extended synaptotagmin 1

There are no transcripts associated with this gene.

Gene: LOC107987175
Gene Name: uncharacterized LOC107987175

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017020294.1		Intron			XP_016875783.1

Gene: MYL6
Gene Name: myosin light chain 6

There are no transcripts associated with this gene.

Gene: MYL6B
Gene Name: myosin light chain 6B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199629.1		Intron			NP_001186558.1
NM_002475.4		Intron			NP_002466.1

Gene: SMARCC2
Gene Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2

There are no transcripts associated with this gene.

View Full Product Details