Product Details

SNP ID: rs3810917
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:113274181 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGAAGTCATCGAAGCAAGCTGTTC[A/C]GTTTGGTTAATAATTTTAGCCTCCT
Phenotype: MIM: 614533 MIM: 607795 MIM: 603085
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CDC26 PubMed Links

Gene Details

Gene: CDC26
Gene Name: cell division cycle 26

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_139286.3		Intron			NP_644815.1
XM_017014573.1		Intron			XP_016870062.1
XM_017014574.1		Intron			XP_016870063.1
XM_017014575.1		Intron			XP_016870064.1

Gene: PRPF4
Gene Name: pre-mRNA processing factor 4

There are no transcripts associated with this gene.

Gene: SLC31A1
Gene Name: solute carrier family 31 member 1

There are no transcripts associated with this gene.

View Full Product Details