Product Details

SNP ID: rs3811404
Assay Type: Functionally tested
NCBI dbSNP Submissions: 14
Location: Chr.1:151170913 on Build GRCh38
Set Membership: HapMap JSNP
Context Sequence [VIC/FAM]: GAATGCTAACATCAGGGGAAGGGAA[C/T]GCTGACCTGATTGTCTACACGGAGC
Phenotype: MIM: 608095 MIM: 605834 MIM: 600607
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LYSMD1 PubMed Links

Gene Details

Gene: LYSMD1
Gene Name: LysM domain containing 1

There are no transcripts associated with this gene.

Gene: SCNM1
Gene Name: sodium channel modifier 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204856.1		Intron			NP_001191785.1
NM_024041.3		Intron			NP_076946.1

Gene: TMOD4
Gene Name: tropomodulin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013353.2		Intron			NP_037485.2
XM_011509449.1		Intron			XP_011507751.1
XM_017001089.1		Intron			XP_016856578.1
XM_017001090.1		Intron			XP_016856579.1

Gene: TNFAIP8L2-SCNM1
Gene Name: TNFAIP8L2-SCNM1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204848.1		Intron			NP_001191777.1

Gene: VPS72
Gene Name: vacuolar protein sorting 72 homolog

There are no transcripts associated with this gene.

View Full Product Details