Product Details

SNP ID: rs3814792
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.13:23889311 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCCCAAGCCGCCCAGCCTTCCGA[C/T]GCACAGCATTCTAGCACCAGAGCAG
Phenotype: MIM: 614148 MIM: 602241
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C1QTNF9B PubMed Links

Gene Details

Gene: C1QTNF9B
Gene Name: C1q and tumor necrosis factor related protein 9B

There are no transcripts associated with this gene.

Gene: C1QTNF9B-AS1
Gene Name: C1QTNF9B antisense RNA 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014442.2	138	Intron			NP_001014442.2
NM_001135816.1	138	Intron			NP_001129288.1

Gene: MIPEP
Gene Name: mitochondrial intermediate peptidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005932.3	138	Missense Mutation			NP_005923.2
XM_011535097.2	138	Intron			XP_011533399.1
XM_011535098.2	138	Missense Mutation			XP_011533400.1

View Full Product Details