Product Details

SNP ID: rs3746136
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:812658 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCGCTCCGCCAGCCCCAGGCCGCCC[G/A]CGTGGCGCCGCAGCGTGGACTCCCG
Phenotype: MIM: 610391 MIM: 600693
Polymorphism: G/A, Transition substitution
Allele Nomenclature
Literature Links: MIR3187 PubMed Links

Gene Details

Gene: MIR3187
Gene Name: microRNA 3187

There are no transcripts associated with this gene.

Gene: MIR4745
Gene Name: microRNA 4745

There are no transcripts associated with this gene.

Gene: PLPPR3
Gene Name: phospholipid phosphatase related 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270366.1	2809	Missense Mutation	GCG,GTG	A690V	NP_001257295.1
NM_024888.2	2809	Missense Mutation	GCG,GTG	A718V	NP_079164.1
XM_011528317.2	2809	Missense Mutation	GCG,GTG	A718V	XP_011526619.1

Gene: PTBP1
Gene Name: polypyrimidine tract binding protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002819.4	2809	Intron			NP_002810.1
NM_031990.3	2809	Intron			NP_114367.1
NM_031991.3	2809	Intron			NP_114368.1
XM_005259597.2	2809	Intron			XP_005259654.1
XM_005259598.2	2809	Intron			XP_005259655.1

View Full Product Details