Product Details

SNP ID: rs3764878
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:67392137 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCAGCCGCGGAGCCGCCAGCCTAAC[C/T]CCCTTCCGCTCTTCTCCCCGCAGTG
Phenotype: MIM: 176875 MIM: 603761
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC100130987 PubMed Links

Gene Details

Gene: LOC100130987
Gene Name: uncharacterized LOC100130987

There are no transcripts associated with this gene.

Gene: PPP1CA
Gene Name: protein phosphatase 1 catalytic subunit alpha

There are no transcripts associated with this gene.

Gene: RAD9A
Gene Name: RAD9 checkpoint clamp component A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243224.1		Intron			NP_001230153.1
NM_004584.2		Intron			NP_004575.1
XM_006718652.3		Intron			XP_006718715.1
XM_017018097.1		Intron			XP_016873586.1
XM_017018098.1		Intron			XP_016873587.1

View Full Product Details