Product Details

SNP ID: rs3774310
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:187722784 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CGACAGATAAGCTAGCGTTGTGCAA[A/G]TGTCCGTTCCCTGCTTTCCCAAGTG
Phenotype: MIM: 109565 MIM: 609138
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BCL6 PubMed Links

Gene Details

Gene: BCL6
Gene Name: B-cell CLL/lymphoma 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130845.1		Intron			NP_001124317.1
NM_001134738.1		Intron			NP_001128210.1
NM_001706.4		Intron			NP_001697.2
XM_005247694.3		Intron			XP_005247751.1
XM_011513062.2		Intron			XP_011511364.1

Gene: LOC100131635
Gene Name: hCG1645011-like

There are no transcripts associated with this gene.

Gene: RTP2
Gene Name: receptor transporter protein 2

There are no transcripts associated with this gene.

View Full Product Details