Product Details

SNP ID: rs12293215
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:111881318 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTTGTTTGGTAACATCAGTGCATGC[A/G]TCTGTCTTCACAAAGGCAGATGGTA
Phenotype: MIM: 606941
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ALG9 PubMed Links

Gene Details

Gene: ALG9
Gene Name: ALG9, alpha-1,2-mannosyltransferase

There are no transcripts associated with this gene.

Gene: C11orf1
Gene Name: chromosome 11 open reading frame 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022761.2		Intron			NP_073598.1
XM_011542957.2		Intron			XP_011541259.1
XM_011542958.2		Intron			XP_011541260.1
XM_017018129.1		Intron			XP_016873618.1

Gene: FDXACB1
Gene Name: ferredoxin-fold anticodon binding domain containing 1

There are no transcripts associated with this gene.

View Full Product Details