Product Details

SNP ID: rs113836571
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:22605962 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAGCAGGAGATGCCCACAGTGATT[G/T]CCAGTGAAGCTCTGTGGAGGAGCTG
Phenotype: MIM: 607359 MIM: 609722
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: C8orf58 PubMed Links

Gene Details

Gene: C8orf58
Gene Name: chromosome 8 open reading frame 58

There are no transcripts associated with this gene.

Gene: CCAR2
Gene Name: cell cycle and apoptosis regulator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021174.5		Intron			NP_066997.3
XM_011544603.1		Intron			XP_011542905.1
XM_011544604.1		Intron			XP_011542906.1
XM_017013717.1		Intron			XP_016869206.1

Gene: LOC107986876
Gene Name: proline-rich proteoglycan 2-like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017014122.1		Intron			XP_016869611.1

Gene: PDLIM2
Gene Name: PDZ and LIM domain 2

There are no transcripts associated with this gene.

View Full Product Details