Product Details

SNP ID: rs4945868
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.6:110959430 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTAATATGTAATTAAGTATAATGT[A/T]GAAGTACAGCGGGGACTATGGGAGC
Phenotype: MIM: 611784
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: GTF3C6 PubMed Links
Additional Information: For this assay, SNP(s) [rs143233557] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_138408.3		Intron			NP_612417.1