Product Details
- SNP ID
-
rs4788581
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:71933792 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CATACCAGTTAAGTGTGGAACTAGA[A/T]CTAAACCCGGCTTTCCTACTGTACC
- Phenotype
-
MIM: 616434
MIM: 607895
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
IST1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs150521564] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- IST1
- Gene Name
- IST1, ESCRT-III associated factor
There are no transcripts associated with this gene.
- Gene
- PKD1L3
- Gene Name
- polycystin 1 like 3, transient receptor potential channel interacting
View Full Product Details