Product Details

SNP ID
rs4245555
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.7:50593712 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
CTATTTTAACTCAGTGAGTTTTCAG[C/T]TGGATGACTGTAGTACAGTGCAAAA
Phenotype
MIM: 601523
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
GRB10 PubMed Links
Additional Information
For this assay, SNP(s) [rs116263181] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
GRB10
Gene Name
growth factor receptor bound protein 10
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001001549.2 Intron NP_001001549.1
NM_001001550.2 Intron NP_001001550.1
NM_001001555.2 Intron NP_001001555.1
NM_005311.4 Intron NP_005302.3
XM_011515304.1 Intron XP_011513606.1
XM_011515312.2 Intron XP_011513614.1
XM_011515316.1 Intron XP_011513618.1
XM_011515323.2 Intron XP_011513625.1
XM_017012029.1 Intron XP_016867518.1
XM_017012030.1 Intron XP_016867519.1
XM_017012031.1 Intron XP_016867520.1
XM_017012032.1 Intron XP_016867521.1
XM_017012033.1 Intron XP_016867522.1
XM_017012034.1 Intron XP_016867523.1
XM_017012035.1 Intron XP_016867524.1
XM_017012036.1 Intron XP_016867525.1
XM_017012037.1 Intron XP_016867526.1
XM_017012038.1 Intron XP_016867527.1
XM_017012039.1 Intron XP_016867528.1
XM_017012040.1 Intron XP_016867529.1
XM_017012041.1 Intron XP_016867530.1
XM_017012042.1 Intron XP_016867531.1
XM_017012043.1 Intron XP_016867532.1
XM_017012044.1 Intron XP_016867533.1
XM_017012045.1 Intron XP_016867534.1
XM_017012046.1 Intron XP_016867535.1
XM_017012047.1 Intron XP_016867536.1
XM_017012048.1 Intron XP_016867537.1
XM_017012049.1 Intron XP_016867538.1
XM_017012050.1 Intron XP_016867539.1
XM_017012051.1 Intron XP_016867540.1
XM_017012052.1 Intron XP_016867541.1
XM_017012053.1 Intron XP_016867542.1
XM_017012054.1 Intron XP_016867543.1
XM_017012055.1 Intron XP_016867544.1
XM_017012056.1 Intron XP_016867545.1
XM_017012057.1 Intron XP_016867546.1
XM_017012058.1 Intron XP_016867547.1
XM_017012059.1 Intron XP_016867548.1
XM_017012060.1 Intron XP_016867549.1
XM_017012061.1 Intron XP_016867550.1
XM_017012062.1 Intron XP_016867551.1
XM_017012063.1 Intron XP_016867552.1
XM_017012064.1 Intron XP_016867553.1
XM_017012065.1 Intron XP_016867554.1
XM_017012066.1 Intron XP_016867555.1
XM_017012067.1 Intron XP_016867556.1
XM_017012068.1 Intron XP_016867557.1

View Full Product Details