Product Details

SNP ID: rs4334414
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:10720997 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGCTGTAAAGTGAGGAGTTAGGTG[C/T]TCTGGGTTGGGAACCTGGGTCTCTC
Phenotype: MIM: 602378 MIM: 609615
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DNM2 PubMed Links

Gene Details

Gene: DNM2
Gene Name: dynamin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005360.2		Intron			NP_001005360.1
NM_001005361.2		Intron			NP_001005361.1
NM_001005362.2		Intron			NP_001005362.1
NM_001190716.1		Intron			NP_001177645.1
NM_004945.3		Intron			NP_004936.2

Gene: MIR638
Gene Name: microRNA 638

There are no transcripts associated with this gene.

Gene: QTRT1
Gene Name: queuine tRNA-ribosyltransferase catalytic subunit 1

There are no transcripts associated with this gene.

View Full Product Details