Product Details

SNP ID

rs4700137

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.5:66596415 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGCACAGTGGAGCGCAGATCGCGGA[C/T]CCGAGCGGGCATGTCCCCGCGCGCG

Phenotype

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

MAST4 PubMed Links

Additional Information

For this assay, SNP(s) [rs141181323] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

MAST4

Gene Name

microtubule associated serine/threonine kinase family member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164664.1	68	UTR 5			NP_001158136.1
NM_001290226.1	68	Intron			NP_001277155.1
NM_001290227.1	68	Intron			NP_001277156.1
NM_001290228.1	68	UTR 5			NP_001277157.1
NM_001297651.1	68	Intron			NP_001284580.1
NM_015183.2	68	Intron			NP_055998.1
NM_198828.2	68	UTR 5			NP_942123.1
XM_006714606.3	68	Intron			XP_006714669.1
XM_006714610.2	68	Intron			XP_006714673.1
XM_011543382.2	68	UTR 5			XP_011541684.1
XM_011543384.2	68	Intron			XP_011541686.1
XM_011543385.2	68	Intron			XP_011541687.1
XM_011543386.2	68	Intron			XP_011541688.1
XM_017009447.1	68	UTR 5			XP_016864936.1
XM_017009448.1	68	UTR 5			XP_016864937.1
XM_017009449.1	68	Intron			XP_016864938.1
XM_017009450.1	68	Intron			XP_016864939.1
XM_017009451.1	68	Intron			XP_016864940.1
XM_017009452.1	68	Intron			XP_016864941.1
XM_017009453.1	68	Intron			XP_016864942.1

View Full Product Details