Product Details

SNP ID: rs4813786
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:6007449 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTAATCTGAGATTAGCTCTCCTAAC[A/G]TTAACTTTGAAACTTTTACGGATTT
Phenotype: MIM: 608188 MIM: 608187
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CRLS1 PubMed Links

Gene Details

Gene: CRLS1
Gene Name: cardiolipin synthase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127458.1		Intron			NP_001120930.1
NM_001323561.1		Intron			NP_001310490.1
NM_001323562.1		Intron			NP_001310491.1
NM_001323563.1		Intron			NP_001310492.1
NM_001323564.1		Intron			NP_001310493.1
NM_019095.5		Intron			NP_061968.1
XM_005260738.4		Intron			XP_005260795.1
XM_011529263.1		Intron			XP_011527565.1

Gene: MCM8
Gene Name: minichromosome maintenance 8 homologous recombination repair factor

There are no transcripts associated with this gene.

Gene: MCM8-AS1
Gene Name: MCM8 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details