Product Details

SNP ID: rs7908746
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:3138537 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGCCACGCTGACCCCTACCCACGCC[C/T]GCTTCTGCAGCAGGGATGCAGTCAG
Phenotype: MIM: 171840
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PFKP PubMed Links

Gene Details

Gene: PFKP
Gene Name: phosphofructokinase, platelet

There are no transcripts associated with this gene.

Gene: PITRM1
Gene Name: pitrilysin metallopeptidase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242307.1		Intron			NP_001229236.1
NM_001242309.1		Intron			NP_001229238.1
NM_014889.3		Intron			NP_055704.2
XM_005252345.3		Intron			XP_005252402.1
XM_017015470.1		Intron			XP_016870959.1
XM_017015471.1		Intron			XP_016870960.1
XM_017015472.1		Intron			XP_016870961.1
XM_017015473.1		Intron			XP_016870962.1

Gene: PITRM1-AS1
Gene Name: PITRM1 antisense RNA 1

There are no transcripts associated with this gene.

Gene: SNORD142
Gene Name: small nucleolar RNA, C/D box 142

There are no transcripts associated with this gene.

View Full Product Details