Product Details

SNP ID: rs7890520
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:15494543 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAAAAGAACAGGTTAGTAGAGGAAC[A/G]AACACTTTTCTCTGGGCTTTTAAAA
Phenotype: MIM: 300335 MIM: 300101 MIM: 300931
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACE2 PubMed Links

Gene Details

Gene: ACE2
Gene Name: angiotensin I converting enzyme 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021804.2	2670	Intron			NP_068576.1
XM_011545549.1	2670	Intron			XP_011543851.1
XM_011545551.2	2670	UTR 3			XP_011543853.1
XM_011545552.1	2670	Intron			XP_011543854.1

Gene: BMX
Gene Name: BMX non-receptor tyrosine kinase

There are no transcripts associated with this gene.

Gene: PIR
Gene Name: pirin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018109.2	2670	Intron			NP_001018119.1
NM_003662.3	2670	Intron			NP_003653.1

Gene: PIR-FIGF
Gene Name: PIR-FIGF readthrough

There are no transcripts associated with this gene.

View Full Product Details