Product Details

SNP ID: rs7848745
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:127707656 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCTCAGTTTCCCCAAATATAAGTG[A/G]GGAAGGTTGATTCCCCCTCCATGGC
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CFAP157 PubMed Links

Gene Details

Gene: CFAP157
Gene Name: cilia and flagella associated protein 157

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001012502.2		Intron			NP_001012520.2
XM_006717064.3		Intron			XP_006717127.2
XM_011518559.2		Intron			XP_011516861.2
XM_017014629.1		Intron			XP_016870118.1
XM_017014630.1		Intron			XP_016870119.1

Gene: PTRH1
Gene Name: peptidyl-tRNA hydrolase 1 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002913.1		Intron			NP_001002913.1
XM_006716955.3		Intron			XP_006717018.1
XM_017014276.1		Intron			XP_016869765.1
XM_017014277.1		Intron			XP_016869766.1
XM_017014278.1		Intron			XP_016869767.1

Gene: TTC16
Gene Name: tetratricopeptide repeat domain 16

There are no transcripts associated with this gene.

View Full Product Details