Product Details

SNP ID: rs7938269
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:556857 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCTTCTGAGTCCCTGCTGTAGCT[C/G]CCGGCCTGCACCAGCGCTTGCTCGG
Phenotype: MIM: 143023
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LMNTD2 PubMed Links

Gene Details

Gene: LMNTD2
Gene Name: lamin tail domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_173573.2	1033	Silent Mutation	GGC,GGG	G318G	NP_775844.2
XM_011519965.2	1033	Silent Mutation	GGC,GGG	G391G	XP_011518267.2
XM_011519967.2	1033	Silent Mutation	GGC,GGG	G391G	XP_011518269.2
XM_017017476.1	1033	Silent Mutation	GGC,GGG	G391G	XP_016872965.1
XM_017017477.1	1033	Silent Mutation	GGC,GGG	G386G	XP_016872966.1
XM_017017478.1	1033	Silent Mutation	GGC,GGG	G323G	XP_016872967.1
XM_017017479.1	1033	Silent Mutation	GGC,GGG	G391G	XP_016872968.1

Gene: LRRC56
Gene Name: leucine rich repeat containing 56

There are no transcripts associated with this gene.

Gene: MIR210HG
Gene Name: MIR210 host gene

There are no transcripts associated with this gene.

Gene: RASSF7
Gene Name: Ras association domain family member 7

There are no transcripts associated with this gene.

View Full Product Details