Product Details

SNP ID: rs6921213
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31623864 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCAATGTCTCACTAGTGCCAAAAG[A/T]CGGAACAGGATGGGCAAGCAAACAG
Phenotype: MIM: 601833 MIM: 142580
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: AIF1 PubMed Links

Gene Details

Gene: AIF1
Gene Name: allograft inflammatory factor 1

There are no transcripts associated with this gene.

Gene: MIR6832
Gene Name: microRNA 6832

There are no transcripts associated with this gene.

Gene: PRRC2A
Gene Name: proline rich coiled-coil 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004638.3	531	Missense Mutation	GAC,GTC	D82V	NP_004629.3
NM_080686.2	531	Missense Mutation	GAC,GTC	D82V	NP_542417.2
XM_017011274.1	531	Missense Mutation	GAC,GTC	D82V	XP_016866763.1

Gene: SNORA38
Gene Name: small nucleolar RNA, H/ACA box 38

There are no transcripts associated with this gene.

View Full Product Details