Product Details

SNP ID: rs7051496
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:120251324 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCCCTAGCCCCTACTTTGATTTA[A/G]AGCTTTTCTGCCAGGCCCATCCTCC
Phenotype: MIM: 300329
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NKAPP1 PubMed Links

Gene Details

Gene: NKAPP1
Gene Name: NFKB activating protein pseudogene 1

There are no transcripts associated with this gene.

Gene: TMEM255A
Gene Name: transmembrane protein 255A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001104544.1	1612	Intron			NP_001098014.1
NM_001104545.1	1612	Intron			NP_001098015.1
NM_017938.3	1612	Intron			NP_060408.3
XM_017029619.1	1612	UTR 3			XP_016885108.1

Gene: ZBTB33
Gene Name: zinc finger and BTB domain containing 33

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001184742.1	1612	Intron			NP_001171671.1
NM_006777.3	1612	Intron			NP_006768.1

View Full Product Details