Product Details

SNP ID: rs7336020
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.13:36303215 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAATAATGTCTAATTAAGTAGCCAC[C/T]AGAAGATCAGAAATTATTAGAATGG
Phenotype: MIM: 607111
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC169 PubMed Links

Gene Details

Gene: CCDC169
Gene Name: coiled-coil domain containing 169

There are no transcripts associated with this gene.

Gene: CCDC169-SOHLH2
Gene Name: CCDC169-SOHLH2 readthrough

There are no transcripts associated with this gene.

Gene: SPG20
Gene Name: spastic paraplegia 20 (Troyer syndrome)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142294.1	3438	UTR 3			NP_001135766.1
NM_001142295.1	3438	UTR 3			NP_001135767.1
NM_001142296.1	3438	UTR 3			NP_001135768.1
NM_015087.4	3438	UTR 3			NP_055902.1
XM_005266313.4	3438	UTR 3			XP_005266370.1
XM_005266314.3	3438	UTR 3			XP_005266371.1
XM_005266315.3	3438	UTR 3			XP_005266372.1
XM_005266317.3	3438	UTR 3			XP_005266374.1
XM_011535012.2	3438	UTR 3			XP_011533314.1

View Full Product Details