Product Details

SNP ID: rs6090347
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63295956 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCACTGAGCGATGGTTTTGTTCC[G/T]CTGGGGTGAAAGGCAGCTCCCCCTT
Phenotype: MIM: 608377
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ARFGAP1 PubMed Links

Gene Details

Gene: ARFGAP1
Gene Name: ADP ribosylation factor GTPase activating protein 1

There are no transcripts associated with this gene.

Gene: COL20A1
Gene Name: collagen type XX alpha 1 chain

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020882.2		Intron			NP_065933.2
XM_011528937.1		Intron			XP_011527239.1
XM_011528938.1		Intron			XP_011527240.1
XM_011528939.1		Intron			XP_011527241.1
XM_011528940.1		Intron			XP_011527242.1

Gene: MIR4326
Gene Name: microRNA 4326

There are no transcripts associated with this gene.

View Full Product Details