Product Details

SNP ID: rs9370567
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:57173571 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGCTTAAGAATTTATTTGGTAATAC[A/C]GTAGTAGACTTGTATAGAATTTCTA
Phenotype: MIM: 603882 MIM: 615708
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: BAG2 PubMed Links

Gene Details

Gene: BAG2
Gene Name: BCL2 associated athanogene 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004282.3		Intron			NP_004273.1
XM_005249490.3		Intron			XP_005249547.1
XM_011514998.2		Intron			XP_011513300.1
XM_011514999.2		Intron			XP_011513301.1

Gene: LOC101927211
Gene Name: uncharacterized LOC101927211

There are no transcripts associated with this gene.

Gene: ZNF451
Gene Name: zinc finger protein 451

There are no transcripts associated with this gene.

View Full Product Details