Product Details

SNP ID: rs8071264
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:64509040 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCACGGCTTAACCTAATCATGGCTA[A/C]TGCCTTGTGAAAGTTGCATCTTTTC
Phenotype: MIM: 180630
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CEP95 PubMed Links

Gene Details

Gene: CEP95
Gene Name: centrosomal protein 95

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316990.1		Intron			NP_001303919.1
NM_138363.2		Intron			NP_612372.1
XM_005257779.3		Intron			XP_005257836.1
XM_005257780.2		Intron			XP_005257837.1
XM_006722166.3		Intron			XP_006722229.1
XM_011525458.2		Intron			XP_011523760.1
XM_017025287.1		Intron			XP_016880776.1
XM_017025288.1		Intron			XP_016880777.1

Gene: DDX5
Gene Name: DEAD-box helicase 5

There are no transcripts associated with this gene.

Gene: MIR3064
Gene Name: microRNA 3064

There are no transcripts associated with this gene.

Gene: MIR5047
Gene Name: microRNA 5047

There are no transcripts associated with this gene.

View Full Product Details