Product Details
- SNP ID
-
rs10404780
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:42926335 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CGGATGTCCAGAAGTAAATATGTCT[A/T]TACTTGGACCGGAGAGAGACTGAGA
- Phenotype
-
MIM: 176395
MIM: 176396
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
PSG6
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs112724259] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PSG6
- Gene Name
- pregnancy specific beta-1-glycoprotein 6
There are no transcripts associated with this gene.
- Gene
- PSG7
- Gene Name
- pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)
View Full Product Details