Product Details

SNP ID
rs5933464
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.X:134797378 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCAATTTTGAAAAGAACCAATAGTT[G/T]GAAAATGCTGGAGCATCAGCTTTCA
Phenotype
Polymorphism
G/T, Transversion substitution
Allele Nomenclature
Literature Links
FAM122B PubMed Links

Gene Details

Gene
FAM122B
Gene Name
family with sequence similarity 122B
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001166599.2 Intron NP_001160071.1
NM_001166600.2 Intron NP_001160072.1
NM_001170756.1 Intron NP_001164227.1
NM_001170757.1 Intron NP_001164228.1
NM_145284.5 Intron NP_660327.2
XM_006724730.2 Intron XP_006724793.1
XM_006724732.2 Intron XP_006724795.1
XM_006724733.3 Intron XP_006724796.1
XM_011531282.1 Intron XP_011529584.1
XM_011531283.1 Intron XP_011529585.1
XM_011531284.1 Intron XP_011529586.1
XM_011531285.1 Intron XP_011529587.1
XM_011531286.1 Intron XP_011529588.1
XM_011531287.1 Intron XP_011529589.1
XM_011531288.1 Intron XP_011529590.1
XM_011531289.1 Intron XP_011529591.1
XM_011531290.1 Intron XP_011529592.1
XM_011531291.1 Intron XP_011529593.1
XM_011531292.1 Intron XP_011529594.1
XM_011531293.1 Intron XP_011529595.1
XM_011531294.1 Intron XP_011529596.1
XM_017029306.1 Intron XP_016884795.1
XM_017029307.1 Intron XP_016884796.1
Gene
FAM122C
Gene Name
family with sequence similarity 122C
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001170779.1 Intron NP_001164250.1
NM_001170780.1 Intron NP_001164251.1
NM_001170781.1 Intron NP_001164252.1
NM_001170782.1 Intron NP_001164253.1
NM_001170783.1 Intron NP_001164254.1
NM_001170784.1 Intron NP_001164255.1
NM_138819.3 Intron NP_620174.1
XM_005262382.1 Intron XP_005262439.1
XM_005262383.2 Intron XP_005262440.1
XM_005262384.4 Intron XP_005262441.1
XM_005262386.3 Intron XP_005262443.1
XM_005262387.3 Intron XP_005262444.1
XM_006724734.3 Intron XP_006724797.1
XM_006724735.1 Intron XP_006724798.1
XM_006724736.2 Intron XP_006724799.1
XM_011531295.1 Intron XP_011529597.1
XM_011531296.2 Intron XP_011529598.1
XM_011531297.2 Intron XP_011529599.1
XM_011531298.2 Intron XP_011529600.1
XM_011531299.1 Intron XP_011529601.1
XM_011531300.2 Intron XP_011529602.1
XM_011531301.2 Intron XP_011529603.1
XM_011531302.2 Intron XP_011529604.1
XM_011531305.2 Intron XP_011529607.1
XM_011531306.2 Intron XP_011529608.1
XM_017029308.1 Intron XP_016884797.1
XM_017029309.1 Intron XP_016884798.1
XM_017029310.1 Intron XP_016884799.1
XM_017029311.1 Intron XP_016884800.1

View Full Product Details