Product Details
- SNP ID
-
rs6126865
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.20:38037212 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGATGTGTTGTCTTTCCATTTTCTA[A/G]GAATAATTTTTAATTTATCCCATTT
- Phenotype
-
MIM: 614694
MIM: 614425
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
RPRD1B
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs143092813] are located under a probe and SNP(s) [rs77937114] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- RPRD1B
- Gene Name
- regulation of nuclear pre-mRNA domain containing 1B
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_021215.3 |
|
Intron |
|
|
NP_067038.1 |
- Gene
- TTI1
- Gene Name
- TELO2 interacting protein 1
There are no transcripts associated with this gene.
View Full Product Details