Product Details

SNP ID: rs10483359
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:30897128 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GATAGAGGCTTTTTCCAAAATTCTA[C/G]TTATAATCATTAGCCATGCCTCTGG
Phenotype: MIM: 603196 MIM: 614766
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: COCH PubMed Links

Gene Details

Gene: COCH
Gene Name: cochlin

There are no transcripts associated with this gene.

Gene: LOC100506071
Gene Name: uncharacterized LOC100506071

There are no transcripts associated with this gene.

Gene: STRN3
Gene Name: striatin 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001083893.1		Intron			NP_001077362.1
NM_014574.3		Intron			NP_055389.3
XM_005267569.3		Intron			XP_005267626.1
XM_005267570.3		Intron			XP_005267627.1

View Full Product Details