Product Details

SNP ID: rs9457730
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:159799543 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACTTTGAGGACCATAGTTCCAAAAC[C/G]CTGTTCAAGTAGAAGCCTAGAATTC
Phenotype: MIM: 611831 MIM: 186980
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MRPL18 PubMed Links

Gene Details

Gene: MRPL18
Gene Name: mitochondrial ribosomal protein L18

There are no transcripts associated with this gene.

Gene: PNLDC1
Gene Name: PARN like, ribonuclease domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271862.1	87	Intron			NP_001258791.1
NM_173516.2	87	Intron			NP_775787.1
XM_011535491.2	87	Intron			XP_011533793.1
XM_011535493.2	87	Intron			XP_011533795.1
XM_017010312.1	87	UTR 5			XP_016865801.1
XM_017010313.1	87	UTR 5			XP_016865802.1
XM_017010314.1	87	UTR 5			XP_016865803.1
XM_017010315.1	87	Intron			XP_016865804.1
XM_017010316.1	87	Intron			XP_016865805.1

Gene: TCP1
Gene Name: t-complex 1

There are no transcripts associated with this gene.

View Full Product Details