Product Details

SNP ID: rs7970682
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:10007469 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATACTACCTCATATACTGATGTAG[A/C]TGTTTTGGTATATTTGACTAGTGAA
Phenotype: MIM: 606783
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CLEC12B PubMed Links

Gene Details

Gene: CLEC12B
Gene Name: C-type lectin domain family 12 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001129998.2		Intron			NP_001123470.1
NM_001319241.1		Intron			NP_001306170.1
NM_001319242.1		Intron			NP_001306171.1
NM_205852.3		Intron			NP_995324.2
XM_011520658.2		Intron			XP_011518960.1
XM_011520663.2		Intron			XP_011518965.1
XM_017019295.1		Intron			XP_016874784.1

Gene: CLEC1B
Gene Name: C-type lectin domain family 1 member B

There are no transcripts associated with this gene.

Gene: LOC102724020
Gene Name: uncharacterized LOC102724020

There are no transcripts associated with this gene.

View Full Product Details