Product Details

SNP ID

rs9822391

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.3:113216266 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ACCGTCTGAGGGTAGCAGCTCGAAA[C/G]TAGAAGAAGTGGGTGAGGTTTTCTC

Phenotype

MIM: 608708

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

BOC PubMed Links

Additional Information

For this assay, SNP(s) [rs146281507] are located under a probe and SNP(s) [rs78586687] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

BOC

Gene Name

BOC cell adhesion associated, oncogene regulated

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301861.1	615	UTR 5			NP_001288790.1
NM_001301867.1	615	UTR 5			NP_001288796.1
NM_033254.3	615	UTR 5			NP_150279.1
XM_005247891.2	615	UTR 5			XP_005247948.1
XM_005247892.2	615	UTR 5			XP_005247949.1
XM_005247897.2	615	UTR 5			XP_005247954.1
XM_011513305.2	615	UTR 5			XP_011511607.1
XM_017007441.1	615	UTR 5			XP_016862930.1
XM_017007442.1	615	UTR 5			XP_016862931.1
XM_017007443.1	615	UTR 5			XP_016862932.1
XM_017007444.1	615	UTR 5			XP_016862933.1
XM_017007445.1	615	UTR 5			XP_016862934.1
XM_017007446.1	615	UTR 5			XP_016862935.1
XM_017007447.1	615	UTR 5			XP_016862936.1
XM_017007448.1	615	UTR 5			XP_016862937.1
XM_017007449.1	615	UTR 5			XP_016862938.1
XM_017007450.1	615	UTR 5			XP_016862939.1
XM_017007451.1	615	UTR 5			XP_016862940.1
XM_017007452.1	615	Missense Mutation	CTA,GTA	L19V	XP_016862941.1
XM_017007453.1	615	Missense Mutation	CTA,GTA	L19V	XP_016862942.1
XM_017007454.1	615	UTR 5			XP_016862943.1
XM_017007455.1	615	UTR 5			XP_016862944.1

View Full Product Details