Product Details

SNP ID
rs7546625
Assay Type
Functionally Tested
NCBI dbSNP Submissions
39
Location
Chr.1:84086923 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
TGGCCTGTTGGTCCTCTGAGCAGGG[A/G]GCTTAACTGTGAACAAATCAGACAA
Phenotype
MIM: 176892
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
PRKACB PubMed Links
Additional Information
For this assay, SNP(s) [rs80179969] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
PRKACB
Gene Name
protein kinase cAMP-activated catalytic subunit beta
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001242857.2 Intron NP_001229786.1
NM_001242858.2 Intron NP_001229787.1
NM_001242859.2 Intron NP_001229788.1
NM_001242860.2 Intron NP_001229789.1
NM_001242861.2 Intron NP_001229790.1
NM_001242862.2 Intron NP_001229791.1
NM_001300915.1 Intron NP_001287844.1
NM_001300916.1 Intron NP_001287845.1
NM_001300917.1 Intron NP_001287846.1
NM_002731.3 Intron NP_002722.1
NM_182948.3 Intron NP_891993.1
NM_207578.2 Intron NP_997461.1
XM_005271015.3 Intron XP_005271072.1
XM_005271016.1 Intron XP_005271073.1
XM_005271017.3 Intron XP_005271074.1
XM_005271018.4 Intron XP_005271075.1
XM_005271019.1 Intron XP_005271076.1
XM_005271020.1 Intron XP_005271077.1
XM_006710758.1 Intron XP_006710821.1
XM_017001706.1 Intron XP_016857195.1
XM_017001707.1 Intron XP_016857196.1
XM_017001708.1 Intron XP_016857197.1
XM_017001709.1 Intron XP_016857198.1
XM_017001710.1 Intron XP_016857199.1
XM_017001711.1 Intron XP_016857200.1
XM_017001712.1 Intron XP_016857201.1
XM_017001713.1 Intron XP_016857202.1
XM_017001714.1 Intron XP_016857203.1
XM_017001715.1 Intron XP_016857204.1
XM_017001716.1 Intron XP_016857205.1
XM_017001717.1 Intron XP_016857206.1
XM_017001718.1 Intron XP_016857207.1
XM_017001719.1 Intron XP_016857208.1
XM_017001720.1 Intron XP_016857209.1

View Full Product Details