Product Details

SNP ID: rs9926070
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:3024515 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACCAGGGGGGCGGGATAGTAACCC[A/C]GAAGTGCTTCAGGGGCTTAACGCAA
Phenotype: MIM: 617003 MIM: 615798 MIM: 615403 MIM: 605914
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: BICDL2 PubMed Links

Gene Details

Gene: BICDL2
Gene Name: BICD family like cargo adaptor 2

There are no transcripts associated with this gene.

Gene: CLDN6
Gene Name: claudin 6

There are no transcripts associated with this gene.

Gene: HCFC1R1
Gene Name: host cell factor C1 regulator 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002017.2		Intron			NP_001002017.1
NM_001002018.2		Intron			NP_001002018.1
NM_001288665.1		Intron			NP_001275594.1
NM_001288666.1		Intron			NP_001275595.1
NM_001288667.1		Intron			NP_001275596.1
NM_001288668.1		Intron			NP_001275597.1
NM_001308070.1		Intron			NP_001294999.1
NM_017885.3		Intron			NP_060355.1
XM_011522559.2		Intron			XP_011520861.1
XM_017023384.1		Intron			XP_016878873.1

Gene: LOC100128770
Gene Name: uncharacterized LOC100128770

There are no transcripts associated with this gene.

Gene: THOC6
Gene Name: THO complex 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142350.1		Intron			NP_001135822.1
NM_024339.3		Intron			NP_077315.2

Gene: TNFRSF12A
Gene Name: TNF receptor superfamily member 12A

There are no transcripts associated with this gene.

View Full Product Details