Product Details

SNP ID: rs12992439
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:26184621 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCGAGCACACGGTGCGCGCCATCA[A/T]CGAGCGCGTGAGGCTGCCGGTGAAC
Phenotype: MIM: 600890
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: GAREM2 PubMed Links

Gene Details

Gene: GAREM2
Gene Name: GRB2 associated regulator of MAPK1 subtype 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001168241.1	913	Missense Mutation	AAC,ATC	N258I	NP_001161713.1
NM_001191033.1	913	Missense Mutation	AAC,ATC	N181I	NP_001177962.1
XM_006711951.3	913	Missense Mutation	AAC,ATC	N258I	XP_006712014.1
XM_011532564.2	913	Missense Mutation	AAC,ATC	N256I	XP_011530866.1
XM_011532565.2	913	Missense Mutation	AAC,ATC	N256I	XP_011530867.1
XM_011532566.2	913	Missense Mutation	AAC,ATC	N139I	XP_011530868.1
XM_011532567.2	913	Missense Mutation	AAC,ATC	N258I	XP_011530869.1

Gene: HADHA
Gene Name: hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit

There are no transcripts associated with this gene.

View Full Product Details