Product Details
- SNP ID
-
hCV30871665
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:218871333 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGGAGAACTGGTTCGCTGAAGTTGC[A/C]TGAGCCCCACTTCCCCCTCACATGT
- Phenotype
-
MIM: 606268
MIM: 604663
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
WNT10A
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs144252451] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- WNT10A
- Gene Name
- Wnt family member 10A
There are no transcripts associated with this gene.
- Gene
- WNT6
- Gene Name
- Wnt family member 6
There are no transcripts associated with this gene.
View Full Product Details