Product Details

SNP ID: rs12991625
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:131054836 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCAAAGGATTTCTACAGGCAGCTG[G/T]TTCTTCTATCAACGCAAGACCAGCT
Phenotype: MIM: 605216
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ARHGEF4 PubMed Links

Gene Details

Gene: ARHGEF4
Gene Name: Rho guanine nucleotide exchange factor 4

There are no transcripts associated with this gene.

Gene: FAM168B
Gene Name: family with sequence similarity 168 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001009993.3		Intron			NP_001009993.2
NM_001321743.1		Intron			NP_001308672.1
NM_001321744.1		Intron			NP_001308673.1
NM_001321745.1		Intron			NP_001308674.1
NM_001321746.1		Intron			NP_001308675.1
NM_001321747.1		Intron			NP_001308676.1
NM_001321748.1		Intron			NP_001308677.1
XM_011510594.2		Intron			XP_011508896.1
XM_017003327.1		Intron			XP_016858816.1
XM_017003328.1		Intron			XP_016858817.1

Gene: POTEI
Gene Name: POTE ankyrin domain family member I

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001277406.1		Intron			NP_001264335.1
XM_011511670.2		Intron			XP_011509972.1
XM_017004732.1		Intron			XP_016860221.1
XM_017004733.1		Intron			XP_016860222.1
XM_017004734.1		Intron			XP_016860223.1
XM_017004735.1		Intron			XP_016860224.1

View Full Product Details