Product Details

SNP ID: rs12048186
Assay Type: Functionally tested
NCBI dbSNP Submissions: 20
Location: Chr.1:183641868 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTGATTGTCTTTCTCTTCTTGAATC[A/C]ATTTTAGAATTTATGGTTTTTAGAA
Phenotype: MIM: 609908 MIM: 604227 MIM: 605667
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: APOBEC4 PubMed Links

Gene Details

Gene: APOBEC4
Gene Name: apolipoprotein B mRNA editing enzyme catalytic polypeptide like 4

There are no transcripts associated with this gene.

Gene: ARPC5
Gene Name: actin related protein 2/3 complex subunit 5

There are no transcripts associated with this gene.

Gene: RGL1
Gene Name: ral guanine nucleotide dissociation stimulator like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297669.1		Intron			NP_001284598.1
NM_001297670.1		Intron			NP_001284599.1
NM_001297671.1		Intron			NP_001284600.1
NM_001297672.1		Intron			NP_001284601.1
NM_015149.4		Intron			NP_055964.3
XM_011509339.2		Intron			XP_011507641.1
XM_011509341.1		Intron			XP_011507643.1
XM_011509342.2		Intron			XP_011507644.1
XM_017000756.1		Intron			XP_016856245.1

View Full Product Details