Product Details

SNP ID: rs12808595
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:57741590 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGCTGCATTCTCGGCCGGGCTCTA[A/G]GCGCCATGGCTCCCCGCGGGAGGAA
Phenotype: MIM: 607914 MIM: 616715
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BTBD18 PubMed Links

Gene Details

Gene: BTBD18
Gene Name: BTB domain containing 18

There are no transcripts associated with this gene.

Gene: C11orf31
Gene Name: chromosome 11 open reading frame 31

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321335.1	341	UTR 5			NP_001308264.1
NM_170746.3	341	UTR 5			NP_734467.1

Gene: TMX2
Gene Name: thioredoxin related transmembrane protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001144012.2	341	Intron			NP_001137484.1
NM_015959.3	341	Intron			NP_057043.1

Gene: TMX2-CTNND1
Gene Name: TMX2-CTNND1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details