Product Details

SNP ID: rs12462191
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:36016960 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCTTTGGGGTCCGGACTGTGGTGAA[A/G]GTGCGTTTGGGCTGCGTCACTGAAG
Phenotype: MIM: 613304 MIM: 607382 MIM: 615535
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ALKBH6 PubMed Links

Gene Details

Gene: ALKBH6
Gene Name: alkB homolog 6

There are no transcripts associated with this gene.

Gene: CLIP3
Gene Name: CAP-Gly domain containing linker protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199570.1	1850	Silent Mutation	ACC,ACT	T512T	NP_001186499.1
NM_015526.2	1850	Silent Mutation	ACC,ACT	T512T	NP_056341.1

Gene: LOC101927572
Gene Name: uncharacterized LOC101927572

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001290056.1	1850	Silent Mutation	AAA,AAG	K16K	NP_001276985.1

Gene: SYNE4
Gene Name: spectrin repeat containing nuclear envelope family member 4

There are no transcripts associated with this gene.

View Full Product Details