Product Details
- SNP ID
-
rs11634505
- Assay Type
- Functionally tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.15:25060769 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- CTACTCCCTATGCATGATGAAGCAT[A/T]TTAGCTCCCTTAGCCAGTTTAAATT
- Phenotype
-
MIM: 605436
- Polymorphism
- A/T, Transversion substitution
- Allele Nomenclature
-
- Literature Links
-
SNORD116-1
PubMed Links
Gene Details
- Gene
- SNORD116-1
- Gene Name
- small nucleolar RNA, C/D box 116-1
There are no transcripts associated with this gene.
- Gene
- SNORD116-2
- Gene Name
- small nucleolar RNA, C/D box 116-2
There are no transcripts associated with this gene.
- Gene
- SNORD116-3
- Gene Name
- small nucleolar RNA, C/D box 116-3
There are no transcripts associated with this gene.
- Gene
- SNORD116-4
- Gene Name
- small nucleolar RNA, C/D box 116-4
There are no transcripts associated with this gene.
- Gene
- SNORD116-5
- Gene Name
- small nucleolar RNA, C/D box 116-5
There are no transcripts associated with this gene.
- Gene
- SNORD116-6
- Gene Name
- small nucleolar RNA, C/D box 116-6
There are no transcripts associated with this gene.
- Gene
- SNORD116-7
- Gene Name
- small nucleolar RNA, C/D box 116-7
There are no transcripts associated with this gene.
- Gene
- SNORD116-8
- Gene Name
- small nucleolar RNA, C/D box 116-8
There are no transcripts associated with this gene.
- Gene
- SNORD116@
- Gene Name
- small nucleolar RNA, C/D box 116 cluster
There are no transcripts associated with this gene.
View Full Product Details