Product Details

SNP ID: rs10892332
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:119185525 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAAAGCCGCAGGTAGGAGGCCAGGA[A/G]AAATCCTCTGCAGGGGACTTTGGGA
Phenotype: MIM: 611947 MIM: 607146
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CCDC153 PubMed Links

Gene Details

Gene: CCDC153
Gene Name: coiled-coil domain containing 153

There are no transcripts associated with this gene.

Gene: NLRX1
Gene Name: NLR family member X1

There are no transcripts associated with this gene.

Gene: PDZD3
Gene Name: PDZ domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001168468.1	51	Intron			NP_001161940.1
NM_024791.3	51	Intron			NP_079067.3
XM_011543000.2	51	Intron			XP_011541302.1
XM_011543001.2	51	Intron			XP_011541303.1
XM_011543002.2	51	UTR 5			XP_011541304.1
XM_011543005.2	51	Intron			XP_011541307.1
XM_017018334.1	51	UTR 5			XP_016873823.1
XM_017018335.1	51	UTR 5			XP_016873824.1
XM_017018336.1	51	UTR 5			XP_016873825.1
XM_017018337.1	51	UTR 5			XP_016873826.1

View Full Product Details